smilequi1283 smilequi1283
  • 01-07-2017
  • Physics
contestada

Consider the equation 2KBr + Cl2 → KCl + Br2. What type of reaction is this?

Respuesta :

Somniache
Somniache Somniache
  • 01-07-2017
That is a double displacement reaction
Answer Link

Otras preguntas

A recipe call for 2 cups of water for every 5 cups of flour. How many cups of water are needed for 1 cup of flour? A. 2 1/2 cups B. 2 cups C. 1/2 cup D. 2/5 cup
What is the surface area of the prism? A. 144 in2 B. 420 in2 C. 288 in2 D. 140 in2 I really don't know where to post a link to the prism pic
Sophia bought 3 yards of trim to put around a rectangular scarf. She wants the width of the scarf to be a whole number that is at least 6 inches and at most 12
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
what rule does static electricity follow
How did the mountains in Greece contribute to the rise of city-states?
an explanation describe if an orange pet mates with another orange pet, can they have any green offspring.
what rule does static electricity follow
The Panama Canal connects what two bodies of water?
_______ is the largest continental biome. It experiences long, cold winters; short, mild summers; and low precipitation. It is characterized by coniferous fore