atowne9441 atowne9441

04-05-2022
History

contestada

Patsy t. Mink was the first woman of color to do what?.

Respuesta :

jbooth12 jbooth12

04-05-2022

Answer: to serve in the U.S. Congress.

Explanation:mark me brainliest

Answer Link

Otras preguntas

How do you find x ????

WILL MARK THE BRAINIEST!!!!! A biologist just found a new organism living in the deep ocean and is unsure whether or not to classify it as an animal. Describe t

An element's atomic number is 64. How many protons would an atom of this element have?

how many moles of NaCl are equivalent to 15.6g NaCl

Using the images or terms, describe how parts of a cell interact to export proteins.

Solving this question

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Since Ramon has 8 liter jug of water and since he fills nine 750 millimeter pitchers with water how much water is left??

How do the structures of alveoli and capillaries support the function of gas exchange?

If o- can give to every other blood type, why cant it recieve other blood types