caidmccullar7 caidmccullar7

02-02-2022
Mathematics

contestada

If 24 is increased to 30, the percent of increase is how much
%.

Respuesta :

iyahuhhh iyahuhhh

02-02-2022

ANSWER: 25 %
(BTW GOT THIS FROM ONLINE, HOPE ITS RIGHT )

Ver imagen iyahuhhh

Answer Link

Otras preguntas

Which sequence shows the numbers in order from least to greatest?

batman jumps off a tall building to stop a mugger who just stole a little old lady's purse. Jayden jumps off of the same building to squash a really scary bug i

The average daily carrying time is 18 minutes. How many minutes would a person carry water in a week? How many days would it be until a person carried water for

please answer fast!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

18] (b) The diagram below shows a uniform beam pivoted at P. The force of gravity on the beam is 425 N. 23" 3.4 m -8.4 m 720 N Determine the magnitude of the re

Write an expression for the calculation divide 8 in half and subtract from 20 divided into fifths.

Best Buy is offering the same percentage discount on all of their TVs. Suppose one TV is marked down from $650 to $546. Based on that percentage discount, what

Which law used in Rome has been adapted by Western democratic governments? a. if someone breaks a person's limb, his limb will be broken b. women must be under

What is the best definition, or description for the term, uplift? Question 12 options: when a low pressure front meets a high pressure front and pushes the clou

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'