ezranevistic
ezranevistic ezranevistic
  • 01-02-2022
  • Biology
contestada

Name two ways that a cell would be harmed if the cell membrane were damaged.

Respuesta :

angeljomarsal2021
angeljomarsal2021 angeljomarsal2021
  • 01-02-2022
Damage to cell membrane can also lead to leakage of important cell constituents required for various metabolism of the cell. There can also be imbalance of electrolyte concentration in the cell which could lead to damage of proteins and organelles of the cell.
Answer Link

Otras preguntas

According to Christian teaching, Jesus taught in ________________or short stories that used analogies to tell religious truth. Stories Analogies Metaphors Parab
PLEASE HELP ME ASAPPP Identify the base of a triangle in which h = 5 ft and A = (5x + 20) ft2 .
What is the value of [(2/3)^0]^-3
Cuanto es (2x+2y=20) (-2x-6y=-52) con método de igualación y método de suma y resta
What is the value of c?
There is no universally agreed-upon definition of cultural competence.
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
9 students can make a poster in 10 hours. How many students should join them so that they all together can make this poster in 6 hours
Farmer brown built a rectangular pen for his chickens using 12 meters of fence. • he used part of one side of his barn as one length of the rectangular pen. • h
If 2/3 + 6 = 7/6p, what is the value of p?