juan72491 juan72491
  • 01-12-2021
  • History
contestada

When was the gold rush.

Respuesta :

tjmgbof91
tjmgbof91 tjmgbof91
  • 01-12-2021

Answer: January 24, 1848

Explanation:

Answer Link
victorclark41
victorclark41 victorclark41
  • 01-12-2021

Answer:

january 24, 1848

Explanation:

This is the correct answer

Answer Link

Otras preguntas

Jonathon paid $237 for 15 pizzas, which included the $12 delivery charge. How much will he pay for 22 pizzas
Josie grew bored of after school, so he called Kate in search of an amusing ____?
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template
In what way was the South a paternalistic society during the days of slavery?
An externality is said to exist when: individual actions are affected by external forces like the loss of U.S. jobs because of competition from abroad. individu
Find the volume of the triangular prism
What are Chemical Structures?
Research has found that instigating and upholding task-oriented conflicts in the decision-making process can be a strategy to counteract biased information seek
the vertices of figure QRST and translation 3 units left and 11 units down to form Q'R'S'T'. Explain the similarities and differences between two figures
An aqueous solution is tested with an electrical conductivity probe.The conductivity probe does not detect an electric current . Which solution was most likely