lesli27 lesli27
  • 02-10-2021
  • Mathematics
contestada

A survey of a group of students was conducted. The students were asked if they were taking a
Math class, a Biology class, or a French class this term. The results are shown in the following Venn
diagram. How many students were taking a math class?

A survey of a group of students was conducted The students were asked if they were taking a Math class a Biology class or a French class this term The results a class=

Respuesta :

jimthompson5910 jimthompson5910
  • 02-10-2021

Answer:  32

Explanation:

We add up the numbers found in the "math" circle

9+7+11+5 = 32

Answer Link

Otras preguntas

define concentric circles
What are the qualities of a good topic? How will you ensure the topic you choose is relevant and interesting?
Paulina works out with a 2.5 kilogram mass. What is the mass of the 2.5 kilogram mass in grams?
Divide the polynomial in the numerator by the trinomial in the denominator m^3-m^2-4m+1 /m^2+2m-3
Express the perimeter of the triangle as a polynomial. 8x+2 5x-4 9x+3
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
What is the diameter of a circle whose circumference measures 86 26/35? Use pi= 22/7
Can someone answer my question plz!!!! It's in the picture and show your work!!!!!
a pine tree measured 40 and 1 over 2 feet tall. Over the next 7 and 1 over 2 years it grew to a height of 57 feet. During the 7 and 1 over 2 years, what was the
Compliant is to stubborn as excited is to