nanaka52646
nanaka52646 nanaka52646
  • 03-09-2021
  • Law
contestada

how do you eat food?

Respuesta :

binojkwt
binojkwt binojkwt
  • 03-09-2021

Answer:

1.Prepare most of your meals at home using whole or minimally processed foods.

2.Make an eating plan each week – this is the key to fast, easy meal preparation.

3.Choose recipes with plenty of vegetables and fruit.

4.Avoid sugary drinks and instead drink water.

5.Eat smaller meals more often.

Answer Link
angie7072 angie7072
  • 04-09-2021
you put it in ur mouth and swallow?
Answer Link

Otras preguntas

In a standard dictionary, where can you find the key to pronunciation marks? A. In an appendix B. In the front of the dictionary C. At the bottom of each page D
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
What is the difference between "Herr" and "Herrn"?
Why did the french revolution happen and who's fault was it
how many 1 1/2 centimeter cubes can fit into a rectangular prism that has a length of 12 centimeters , a width of 6 centimeters and a height of 9 centimeters
How did i travel irf i went from nyc to tren ton a distance of90 miles at45 miles per hour how long did it take
5. On average, how many years earlier do smokers die than nonsmokers? (Points : 1) 5 to 6 10 to 11 13 to 14 19 to 20
round 7,782 to the nearest hundred
How well did feudalism establish order in the Middle ages?
In terms of weather, what kind of boundary does the line labeled  X represent? A. occluded front B. stationary front C. cold front D. warm front