alexavanclark alexavanclark

03-06-2021
Medicine

contestada

A community’s emergency medical system will include _________.

Respuesta :

codingqueen4000 codingqueen4000

03-06-2021

Answer:

EMS

Explanation:

Answer Link

emerald2011 emerald2011

04-06-2021

An EMS system comprises all of the following components: Agencies and organizations (both private and public) Communications and transportation networks. Trauma systems, hospitals, trauma centers, and specialty care centers.

Answer Link

Otras preguntas

Plants absorb nutrients from soil, and nutrients help plants grow. Which level of organization best describes this interaction between plants and soil? communi

Which two sets of lines in the poem illustrate that death's power is an illusion? Sonnet 10 by John Donne Death, be not proud, though some have called thee Mig

3∙(a+x), if a=8; x=−10

Which pair of verbs best completes this informal imperative sentence? ________ y _________ todo sin límite. Beba, coma Bebe, come Bebemos, comemos Bebis

Why was the Neolithic revolution important

Can I get some help with these questions thank you

The area of a rectangle is 55 m^2 , and the length of the rectangle is 4 m less than three times the width. Find the dimensions of the rectangle.

Please help ASAP!!!!!!!!!!!!!

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

A 2000 calorie diet in which carbohydrate provides 50% of the calories would provide how many grams of carbohydrate?