smartman53 smartman53
  • 03-03-2021
  • Mathematics
contestada

which property is illustrated by the statement (3 × 6) × 4 = 3 × (6 × 4)?​

Respuesta :

SaahilG
SaahilG SaahilG
  • 03-03-2021

Answer:

The Associative Property of Multiplication

Step-by-step explanation:

The Associative Property of Multiplication states that no matter how three or more numbers being multiplied are grouped, the answer will remain the same.

Answer Link

Otras preguntas

Susan ........ (Run) to school because she was late.
Gina rented shoes, bowled 3 games, and bought 1 order of nachos. she used a coupon for 1/2 off the price of her bowling games. What was Ginas total cost before
in what area of Europe were the majority of warsaw pact countries
A flatbed truck is loaded 7,000 pounds of bricks. How many tons of bricks are on the truck?
which of these was a result of the treaty of Brest-Litovsk? A. The end of world war 1 B. Russia's withdrawal from the war C. The end of Austria-Hungrays war w
When 40 is added to the number of miles Karen ran last week, the result is the same as adding 10 to 4 times the number of miles she ran last week. How many mile
There are 23 tables in the library. Each table has 4 chairs. Third grader fill the chairs at 3 tables. Fourth graders fill the chairs at 6 tables. The rest of t
an explanation describe if an orange pet mates with another orange pet, can they have any green offspring.
The _______ system breaks down food, and the _______ system transports nutrients to the cells of the body.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5