amushkhan amushkhan
  • 04-01-2021
  • English
contestada

Who wrote animal farm

Respuesta :

zachlieberstein
zachlieberstein zachlieberstein
  • 04-01-2021

Answer:

the farmer

Explanation:

he owns the farm

Answer Link

Otras preguntas

During the 1920s, more and more neighborhoods were wired so that households could use electricity. Most women at that time worked in the home, taking care of th
Land plants are divided into two main groups. They are_____and_____. A.vascular; nonvascular B.flowering; nonflowering
On a flat, level road, a 1500-kilogram car travels around a curve having a constant radius of 45 meters. The centripetal acceleration of the car has a constant
Approximate the square root of 15 to the nearest integer
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template
What background knowledge would best add to a reader's understanding of a newspaper article about climate change?
Here is an inequality: -2x > 10. List some values for x that would make this inequality true. AT least 2
1. If money is deposited in a bank that pay's simple interest of 4.5 %, bow much will have to be deposited to earn $90 of interest for 8 months​
2) If the initial velocity of an object is equal to a final velocity, what is the acceleration of the object?
help please i’ll give brainliest