jgarrido4460
jgarrido4460 jgarrido4460
  • 04-01-2021
  • Mathematics
contestada

4) Graph by making a
table.
y=2x

4 Graph by making a table y2x class=

Respuesta :

rebeccarayshma
rebeccarayshma rebeccarayshma
  • 04-01-2021

Answer:

the first pic is the table of values

the second pic shows the shape of your graph

Ver imagen rebeccarayshma
Ver imagen rebeccarayshma
Answer Link

Otras preguntas

How was the battle of bunker hill an american success even though it was a british victory?
For hundreds of years before India’s independence from Great Britain, Hindus and Muslims had been A.independent B.peaceful C.separate D.hostile
What is a sample vs a population
What is - 3/8 divided by 7/12 a. - 7/32 b. - 32/7 c. - 14/9 d. - 9/14
William Blake believed that it was necessary to A. use experience as the pathway to God. B. eradicate evil from the human condition. C. fear darkness or lose
What are some examples of dramatic irony in The Hobbit?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
you rent a well-lit flat in philidelpia for $1,080 per month. your landlord, knowing that new apatments are being built nearby, decreases you rent by 3%each yea
Which component of a phospholipid is found in the interior of a lipid bilayer?
Find the length of a leg of an isosceles right triangle whose hypotenuse measures 8√2