vikky85 vikky85
  • 03-12-2020
  • Chemistry
contestada

help with this question

help with this question class=

Respuesta :

vinny1203 vinny1203
  • 03-12-2020
Complementary DNA strand have the letters switched from each other. That would be:

A -> T OR T -> A
And
C -> G OR G -> C

As well as the direction of the strand:
5’ -> 3’ to 3’ -> 5’


For the first set:

DNA: 5’ - ATTATCGCGTAGCTAGCAGT - 3’
Comp: 3’ - TAATAGCGCATCGATCGTCA - 5’

As you can see the strands are the opposite from one another.

Try out the second set of strands and if you’re still having struggles let me know in the comments (:
Answer Link

Otras preguntas

The radius of a circle is 3 millimeters. What is the circle's circumference? r=3 mm Use 3.14 for .
WILL GIVE BRAINLIEST!!!!!!!!!!! The local amusement park has decided to stop printing paper copies of the park map. It will now only be available as a digital f
why is 6 scared of 7.....cuz 789aaaaaaahhhhhhhhhhhhh​
which body cavity is located inferior to the thoracic diaphragm and superior to the pelvic brim of the hip bones
What did the first group of accused "witches" have in common?​
All autotrophs produce valuable organic molecules. What makes these organic molecules so valuable to living organisms
What did the 1862 homestead act promise "homesteaders"?
What methods may an economist use to test a hypothesis? A. Wait for real-world events to confirm or refute the hypothesis. B. Conduct one or more experiments. C
Where do you get 100 from ?
Solve for x x to the power of 2 = 0.49