zmarahbrown zmarahbrown
  • 02-12-2020
  • Mathematics
contestada

-6 -3x=5x -4x can somebody solve this ?

Respuesta :

Smilex Smilex
  • 02-12-2020

Isolate the variable by dividing each side by factors that don't contain the variable.

Exact Form:

x = −3/2

Decimal Form:

x = −1.5

Mixed Number Form:

x = −1/1/2

Answer Link

Otras preguntas

The available farmland in Mali is in the northeast. True or false
Name all of the traits that the mackerel has, based on this cladogram.
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Will bought a package of 24 juice bottles for $7.44. Which equation relates the cost, c, of a package of juice bottles to the number of bottles, b, in the packa
The federalist papers were published in 1787 and 1788 to help gain support for
In judith ortiz cofer's "gravity," what is elenita's main internal conflict? a.she wants an independent identity, and yet still feels a connection to others. b.
Given the sequence in the table below, determine the sigma notation of the sum for term 4 through term 15. n an 1 4 2 −12 3 36
Exponential Equation WITHOUT CALCULATOR
Differences between body composition- risk for heart disease or chronic disease.
I=$310 P==$1,000 t=5 years