03-03-2020
Mathematics

contestada

Solve each system of equations by graphing
h(x)=2x-3
k(x)=3x-4

Respuesta :

mcastillo9 mcastillo9

03-03-2020

Answer:

(1,-1)

Step-by-step explanation:

See attachment.

Ver imagen mcastillo9

Answer Link

Otras preguntas

Alice spent 6 minutes on each factoring problem and 3 minutes on each evaluation problem. she spent a total of 42 minutes on 9 problems. how many minutes did sh

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

if the accuracy in measuring the position of a particle increases, what happens to the accuracy in measuring its velocity?

What is the scale factor in the dilation? A) 2/5 B) 1/2 C) 2 D) 2 and 1/2

When a red blood cell is placed in hypertonic (very concentrated) solutions of nacl?

A sample of gas at 25ºc has a volume of 11 l and exerts a pressure of 660 mm hg. how many moles of gas are in the sample?

Frederick douglass' ability to read and write furthered the ______________ movement that ultimately put an end to ________________ in the u.s.

Judith has recently been diagnosed with cancer. her quality of life is now poor because her coping style is one of helplessness and she has problems expressing

The striton family had a meal catered for a wedding rehearsal dinner. The cost of the dinner was $476. There was a 5% sales tax and they left a 15% tip. What wa

I just need help with the equation part since when I keep doing I get the wrong answer.