huntergulledge911
huntergulledge911 huntergulledge911
  • 03-03-2019
  • Mathematics
contestada

I need num 6 see attached

I need num 6 see attached class=

Respuesta :

omariervingowna46
omariervingowna46 omariervingowna46
  • 03-03-2019

Answer: (A) this is the answer

Step-by-step explanation: If the car keeps traveling at the constant speed the distance traveled will increase over time.

Answer Link
brittenybrittenyflor brittenybrittenyflor
  • 03-03-2019
the answer is A for f(x)
Answer Link

Otras preguntas

PLEASE HELP ASAP what is the correct product of (7x - 3)(7x + 3).49x^2 + 949x^2 - 42x + 9 49x^2 - 949x^2 + 42x + 9
Some puritans wanted to separate from the Church of England
Why did some americans feel that the united states should help europe after world war ii?
A newly formed country in the Caribbean has no high tariffs, yet other countries find it difficult to trade with the new country because of its requirements for
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
A mudflow consists of debris with a large amount of
What was the result of the anti-nephi-lehies becoming converted unto the lord?
How many natural numbers less than 300 are either multiples of 2 or multiples of 3?
Why do you think the Little Rock Nine deserve to be admired? Give two reasons for your opinion.
Determine the total time that must elapse until only 1/16 of an original sample of th-234 remains unchanged.